Recombinant S. pyogenes CRISPR-associated Protein 9, CF

Quantitative analysis of the substrate cleavage by densitometry of the agarose gel. Errorbars display standard error of 3 replicates. 9957-C9 has equivalent activity to a Leading Competitor's Cas9 using the insert assay protocol.

Agarose gel image of in vitro cleavage of DNA substrate into two DNA products by 9957-C9 and a Leading Competitor's Cas9.

2 μg/lane of Recombinant S.pyogenes CRISPR-Cas9 was resolved with SDS-PAGE underreducing (R) and non-reducing (NR) conditions and visualized by Coomassie® Blue staining, showing a band at ~130 kDa.

• Reactivity: Ba
• Applications: Enzyme Activity
• Format: Carrier-Free

Recombinant S. pyogenes CRISPR-associated Protein 9, CF Summary

• Additional Information: Purified CAS9 with Nuclear Localization Sequence
• Details of Functionality: Measured by its ability to cleave a targeted DNA substrate. S. pyogenes CRISPR-Cas9 achieves >80% substrate cleavage, as measured under the described conditions.
• Source: E. coli-derived s. pyogenes CRISPR-Cas9 protein
  

  APKKKRKVGIHGVPAA	S. pyogenes CRISPR-Cas9 (Asp2-Asp1368) Accession # Q99ZW2	KRPAATKKAGQAKK-KKGYGRKKRRQRRRG	HHHHHH
  N-terminus			C-terminus

• N-terminal Sequence: Ala
• Protein/Peptide Type: Recombinant Proteins
• Purity: >95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining.
• Endotoxin Note: <0.10 EU per 1 μg of the protein by the LAL method.

Applications/Dilutions

• Dilutions:
  • Enzyme Activity
• Theoretical MW: 164 kDa.
  Disclaimer note: The observed molecular weight of the protein may vary from the listed predicted molecular weight due to post translational modifications, post translation cleavages, relative charges, and other experimental factors.
• SDS-PAGE: 133 kDa, reducing conditions

Packaging, Storage & Formulations

• Storage: Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
  • 6 months from date of receipt, -20 to -70 °C as supplied.
  • 3 months, -20 to -70 °C under sterile conditions after opening.
• Buffer: Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP.
• Purity: >95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining.
• Assay Procedure:
  • Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl₂, 100 µg/mL BSA, pH 7.9
  • Recombinant Streptococcus pyogenes CRISPR-Cas9 (rS. pyogenes Cas9) (Catalog # 9957-C9)
  • PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)*
  • Dharmacon synthetic sgRNA, targeting sequence: GAGGCAGACAAGGTATAGGG
  • Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328)
  • Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer
  • DNA gel

  *Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5).

  1. Prepare RNP Complex:
     a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)
     b. 0.25 μg rS. pyogenes Cas9
     c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL
     d. Incubate for 5 minutes at 37 °C.
  2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).
  3. Incubate for 1 hour at 37 °C.
  4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.
  5. Load total reaction with loading dye on a 1% agarose gel.
  6. Run gel at 140 V for 40 minutes.
  7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.
  8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.
  Per Reaction:
  • rS. pyogenes Cas9: 0.25 μg
  • DNA Substrate: 30 ng
  • sgRNA: 600 nM

Notes

This product is produced by and ships from R&D Systems, Inc., a Bio-Techne brand.

Alternate Names for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

• Cas9
• CRISPR
• CRISPR/Cas9
• CRISPR-associated endonuclease Cas9/Csn1
• CRISPR-associated protein 9 nuclease
• CRISPR-Cas9
• CRISPR-Cas9/Csn1
• csn1
• SPy_1046
• SPy1046
• SpyCas9

Background

Streptococcus pyogenes Cas9 (CRISPR associated protein 9) is a 160 kDa RNA guided endonuclease that introduces site specific cleavage of double strand DNA (1). It is part of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system found in many bacteria such as S. pyogenes and most archaea, which provide adaptive immunity against invading mobile genetic elements (such as viruses, transposable elements and conjugative plasmids) (2, 3). Upon viral infection, short viral DNA (known as "spacers") integrate into the host genome between CRISPR repeats, and RNA sequences (guide RNA or gRNA) with this genetic information help guide Cas9 protein to recognize and cut foreign DNA. Cas9 protein undergoes conformational changes upon gRNA binding that shift from non-DNA binding conformation into an active DNA binding conformation. In the Cas9-gRNA complex, the gRNA sequence remains accessible to interact with free DNA, and the extent to which the gRNA spacer and target DNA segment (known as "protospacer") match will determine the cut site (4). The presence of a 5′-NGG-3′ protospacer adjacent motif (PAM) sequence immediately downstream of protospacers is required for Cas9 cleavage of the foreign DNA. PAM is absent in bacterial CRISPR loci, therefore preventing cleavage of the host genome (4). Cas9 associates with other proteins of the acquisition machinery (Cas1, Cas2 and Csn2), presumably to provide PAM specificity to this process (5). This RNA guided nuclease system called CRISPR/Cas (CRISPR associated protein) has been widely applied to genome engineering with increased efficiency (6). The attached nuclear localization signals(NLSs) on the chimeric protein ensures nuclear compartmentalization in mammalian cells during gene editing (7).

1. Feng, Z. et al. (2013) Cell 154:1380.
2. Moineau. et al. (2010) Nature 468:67.
3. Barrangou, R. et al. (2014) Molecular Cell 54:234.
4. Charpentier, E. et al. (2011) Nature 471:602.
5. Heler, R. et al. (2015) Nature 519:199.
6. Thomson, J.A. et al. (2013) PNAS,110:15644.
7. Cong, L. et al. (2013) Science 339:819.